The diagnostic accuracy of digital PCR, ARMS and NGS for detecting KRAS mutation in cell-free DNA of patients with colorectal cancer: A protocol for systematic review and meta-analysis

The diagnostic accuracy of digital PCR, ARMS and NGS for detecting KRAS mutation in cell-free DNA of patients with colorectal cancer: A protocol for systematic review and meta-analysis

Introduction: Cetuximab and panitumumab has been used clinically to treat metastatic colorectal cancer for over 15 years. Before the treatment is given, it is necessary to determine the KRAS mutation status because it would lead to drug resistance. tumor tissue sample is traditionally used for genotyping of cancer. In recent years, the biopsy sample liquid has been intensively investigated as a substitute for tumor tissue samples for non-invasive and better presentation of tumor heterogeneity.

The purpose of this study was to systematically summarize the accuracy of the measurement of KRAS mutations in colorectal cancer using the cell-free DNA in the sample liquid biopsy, the tumor tissue samples as reference (gold standard).
Methods and analysis: We will find literature in the following databases: Pubmed, Embase, and the Cochrane Library. systemic review and meta-analysis will be conducted to summarize the accuracy of the measurement of KRAS mutations in colorectal cancer using biopsy samples of liquid and subgroup analyzes will be performed on different testing platforms, and in colorectal cancer metastatic and non-metastatic.
Timeline: The research will begin on June 1, 2020, and is expected to be completed date of 1 November 2020.

Ethics and deployment: Ethics approval will not be required because the data obtained and analyzed in this study will not be in each patient. The results of the research will be disseminated as an official publication in peer-reviewed

A PCR-based NGS protocol for whole genome sequencing of West Nile virus 2 direct descendant of biological specimens.

Lineage 2 West Nile virus (WNV) strain has been involved in a severe outbreak of encephalitis in humans and equines which are in Europe. WNV molecular characterization is important for the development of diagnostic tests, and to obtain molecular information, which is necessary for epidemiological investigations in areas at risk of virus transmission.

For whole-genome sequencing of strains of WNV lineage 2, directly from biological specimens, PCR-based NGS protocol developed. This method is applied to the WNV-positive specimens were obtained from animals, human and mosquito hosts in Greece. Outcomes of the application shows that, even in the case of a low viral titers, developed PCR-based NGS approach capable of providing whole genome sequence of strain lineage 2 WNV.

The diagnostic accuracy of digital PCR, ARMS and NGS for detecting KRAS mutation in cell-free DNA of patients with colorectal cancer: A protocol for systematic review and meta-analysis
The diagnostic accuracy of digital PCR, ARMS and NGS for detecting KRAS mutation in cell-free DNA of patients with colorectal cancer: A protocol for systematic review and meta-analysis

The latest trends in molecular diagnostics yeast infection: PCR for NGS.

The incidence of opportunistic yeast infections in humans has increased in recent years. These infections are difficult to treat and diagnose, partly because the large number and wide variety of species that can be underlying infection.

Moreover, resistance to one or more of antifungal drugs in a strain that infects more and more reported, severely limiting therapeutic options and to show the need for rapid detection of infecting agents and the profile of its drug susceptibility.

Current methods for species identification of constraints and shortage of sensitivity and specificity were satisfactory, and often require a previous culture of the infecting agent, which delays diagnosis.

Recently developed high-throughput technologies such as next-generation sequencing or proteomics opens a completely new way to diagnose more sensitive, accurate and rapid pathogenic yeast. These approaches are the focus of intensive research, but the translation to the clinic needed to overcome important challenges. In this review, we provide an overview of existing approaches and recently appeared which can be used in the identification of the yeast pathogens and their drug resistance profile.

CD79B Antibody

CSB-PA004958KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CD79B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

CD79B Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CD79B Antibody

DF6767 200ul
EUR 304
Description: CD79B Antibody detects endogenous levels of total CD79B.

CD79B Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

CD79B Antibody

AF4649 200ul
EUR 376
Description: CD79B Antibody detects endogenous levels of CD79B.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CD79B Antibody

ABD6767 100 ug
EUR 438


YF-PA10819 50 ul
EUR 363
Description: Mouse polyclonal to CD79b


YF-PA10820 50 ug
EUR 363
Description: Mouse polyclonal to CD79b


YF-PA10821 100 ul
EUR 403
Description: Rabbit polyclonal to CD79b


YF-PA10822 100 ug
EUR 403
Description: Rabbit polyclonal to CD79b


YF-PA23403 50 ul
EUR 334
Description: Mouse polyclonal to CD79b

Human CD79B Antibody

32245-05111 150 ug
EUR 261

CD79b antibody (FITC)

61R-1107 100 tests
EUR 403
Description: Mouse monoclonal CD79b antibody (FITC)

CD79b antibody (PE)

61R-1273 100 tests
EUR 370
Description: Mouse monoclonal CD79b antibody (PE)

CD79b antibody (biotin)

61R-CD79bbMSBT 500 ug
EUR 457
Description: Hamster monoclonal CD79b antibody (biotin)

CD79b antibody (FITC)

61R-CD79bbMSFT 500 ug
EUR 457
Description: Hamster monoclonal CD79b antibody (FITC)

CD79b antibody (PE)

61R-CD79bbMSPE 100 ug
EUR 295
Description: Hamster monoclonal CD79b antibody (PE)

CD79b Polyclonal Antibody

41662-100ul 100ul
EUR 252

CD79b Polyclonal Antibody

41662-50ul 50ul
EUR 187

CD79B Blocking Peptide

DF6767-BP 1mg
EUR 195

CD79B, human recombinant

EUR 365

CD79b Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CD79b Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

CD79b Antibody (FITC)

abx139338-100tests 100 tests
EUR 425
  • Shipped within 5-12 working days.

CD79B Blocking Peptide

AF4649-BP 1mg
EUR 195

CD79B Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD79B Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD79B Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CD79B cloning plasmid

CSB-CL004958HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 240
  • Sequence: atggccaggctggcgttgtctcctgtgcccagccactggatggtggcgttgctgctgctgctctcaggtacagaacccacgacgaggcctgtggggtttgctctcatctccagctgtctgggccctgcggctctgcctcctgcttgctccaccctcctcctctgtctctcactctt
  • Show more
Description: A cloning plasmid for the CD79B gene.

CD79B cloning plasmid

CSB-CL004958HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 690
  • Sequence: atggccaggctggcgttgtctcctgtgcccagccactggatggtggcgttgctgctgctgctctcagctgagccagtaccagcagccagatcggaggaccggtaccggaatcccaaaggtagtgcttgttcgcggatctggcagagcccacgtttcatagccaggaaacggggctt
  • Show more
Description: A cloning plasmid for the CD79B gene.

CD79b Polyclonal Antibody

ABP52986-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD79b
  • Applications tips:
Description: A polyclonal antibody for detection of CD79b from Human. This CD79b antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD79b

CD79b Polyclonal Antibody

ABP52986-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD79b
  • Applications tips:
Description: A polyclonal antibody for detection of CD79b from Human. This CD79b antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD79b

CD79b Polyclonal Antibody

ABP52986-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human CD79b
  • Applications tips:
Description: A polyclonal antibody for detection of CD79b from Human. This CD79b antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human CD79b

CD79B Rabbit pAb

A2033-100ul 100 ul
EUR 308

CD79B Rabbit pAb

A2033-200ul 200 ul
EUR 459

CD79B Rabbit pAb

A2033-20ul 20 ul
EUR 183

CD79B Rabbit pAb

A2033-50ul 50 ul
EUR 223

CD79b Polyclonal Antibody

ES3985-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CD79b from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

CD79b Polyclonal Antibody

ES3985-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CD79b from Human. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Anti-CD79b Antibody

PB9169 100ug/vial
EUR 334

Anti-CD79B antibody

STJ23012 100 µl
EUR 277
Description: The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-CD79b antibody

STJ96620 200 µl
EUR 197
Description: Rabbit polyclonal to CD79b.

CD79b antibody (Azide Free)

10R-CD79bbMSP 500 ug
EUR 565
Description: Hamster monoclonal CD79b antibody (Azide Free)

Anti-Ms CD79b Purified

11-584-C100 0.1 mg
EUR 149

Anti-Hu CD79b Purified

11-676-C025 0.025 mg
EUR 99

Anti-Hu CD79b Purified

11-676-C100 0.1 mg
EUR 158

Anti-Hu CD79b APC

1A-676-T025 25 tests
EUR 140

Anti-Hu CD79b APC

1A-676-T100 100 tests
EUR 240

Anti-Ms CD79b FITC

1F-584-C100 0.1 mg
EUR 167

Anti-Hu CD79b FITC

1F-676-T025 25 tests
EUR 122

Anti-Hu CD79b FITC

1F-676-T100 100 tests
EUR 204

Anti-Ms CD79b PE

1P-584-C025 0.025 mg
EUR 113

Anti-Ms CD79b PE

1P-584-C100 0.1 mg
EUR 186

Anti-Hu CD79b PE

1P-676-T025 25 tests
EUR 140

Anti-Hu CD79b PE

1P-676-T100 100 tests
EUR 240

CD79B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CD79B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CD79B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CD79B. Recognizes CD79B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CD79B protein (His tag)

80R-2614 100 ug
EUR 322
Description: Purified recombinant CD79B protein

Mouse Cd79b ELISA KIT

ELI-25434m 96 Tests
EUR 865

Phospho-CD79B(Tyr207) Antibody

AF4349 200ul
EUR 376
Description: Phospho-CD79B(Tyr207) Antibody detects endogenous levels of CD79B only when phosphorylated at Tyr207.

Human CD79B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CD79B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-34173h 96 Tests
EUR 824

Anti-CD79B Monoclonal Antibody

M01399 100ug
EUR 397
Description: Rabbit Monoclonal CD79B Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

CD79B Human Recombinant Protein

PROTP40259 Regular: 20ug
EUR 317
Description: CD79B Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 155 amino acids (29-159a.a) and having a molecular mass of 17.7kDa. ;CD79B is fused to a 24 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

pCMV-SPORT6-CD79B Plasmid

PVT16709 2 ug
EUR 325

pCMV-SPORT6-CD79B Plasmid

PVT16724 2 ug
EUR 325

CD79B Recombinant Protein (Human)

RP006418 100 ug Ask for price

CD79B Recombinant Protein (Human)

RP006421 100 ug Ask for price

CD79B Recombinant Protein (Rat)

RP194027 100 ug Ask for price

CD79B Recombinant Protein (Mouse)

RP122705 100 ug Ask for price

Anti-CD79b (4E10-2A10)

YF-MA12351 100 ug
EUR 363
Description: Mouse monoclonal to CD79b

Human CD79B Antibody (Biotin Conjugate)

32245-05121 150 ug
EUR 369

CD79b MonoSpecific Antibody, Unconjugated-20ug

974-MSM4-P0 20ug
EUR 233

CD79b MonoSpecific Antibody, Unconjugated-100ug

974-MSM4-P1 100ug
EUR 428

Phospho-CD79B(Tyr207) Blocking Peptide

AF4349-BP 1mg
EUR 195


ADC-W-527 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody conjugated via a MCC linker to DM1


ADC-W-528 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody conjugated via a MC linker to MMAF

Anti-CD79b Antibody (monoclonal, 6H11)

M01399-1 100ug/vial
EUR 334

Cd79b ORF Vector (Rat) (pORF)

ORF064677 1.0 ug DNA
EUR 506

CD79B ORF Vector (Human) (pORF)

ORF002140 1.0 ug DNA
EUR 95

CD79B ORF Vector (Human) (pORF)

ORF002141 1.0 ug DNA
EUR 95

Cd79b ORF Vector (Mouse) (pORF)

ORF040903 1.0 ug DNA
EUR 506

Recombinant Human CD79B/B29 Protein

RP00565 10 μg
EUR 221

Anti-Hu CD79b PerCP-Cy5.5

T9-676-T025 25 tests
EUR 196

Anti-Hu CD79b PerCP-Cy5.5

T9-676-T100 100 tests
EUR 352

CD79B ELISA Kit (Human) (OKCA01119)

OKCA01119 96 Wells
EUR 846
Description: Description of target: Required in cooperation with CD79A for initiation of the signal transduction cascade activated by the B-cell antigen receptor complex (BCR) which leads to internalization of the complex, trafficking to late endosomes and antigen presentation. Enhances phosphorylation of CD79A, possibly by recruiting kinases which phosphorylate CD79A or by recruiting proteins which bind to CD79A and protect it from dephosphorylation.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 1.56 pg/mL

CD79B ELISA Kit (Mouse) (OKCA01632)

OKCA01632 96 Wells
EUR 846
Description: Description of target: Required in cooperation with CD79A for initiation of the signal transduction cascade activated by the B-cell antigen receptor complex (BCR) which leads to internalization of the complex, trafficking to late endosomes and antigen presentation. Enhances phosphorylation of CD79A, possibly by recruiting kinases which phosphorylate CD79A or by recruiting proteins which bind to CD79A and protect it from dephosphorylation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.04 ng/mL

Human CD79B AssayLite Antibody (FITC Conjugate)

32245-05141 150 ug
EUR 428

Human CD79B AssayLite Antibody (RPE Conjugate)

32245-05151 150 ug
EUR 428

Human CD79B AssayLite Antibody (APC Conjugate)

32245-05161 150 ug
EUR 428

Human CD79B AssayLite Antibody (PerCP Conjugate)

32245-05171 150 ug
EUR 471

Cluster of Differentiation 79B (CD79B) Antibody

abx117180-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Cluster of Differentiation 79B (CD79b) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cluster of Differentiation 79B (CD79b) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Cluster of Differentiation 79B (CD79b) Antibody

abx139336-01mg 0.1 mg
EUR 356
  • Shipped within 5-12 working days.

Cluster of Differentiation 79B (CD79B) Antibody

abx028989-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cluster of Differentiation 79B (CD79B) Antibody

abx028989-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Rat Anti Mouse Cd79b Monoclonal Antibody

CABT-49746RM 0.2 mg
EUR 767

Recombinant Human CD79B/B29 (C-6His)

CA29-10ug 10ug
EUR 202
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human CD79B/B29 (C-6His)

CA29-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human CD79B/B29 (C-6His)

CA29-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Recombinant Human CD79B/B29 (C-6His)

CA29-50ug 50ug
EUR 496
Description: Lyophilized from a 0.2 μm filtered solution of 20mM PB,150mM NaCl,pH7.4.

Anti-CD79b (SN8)-SPP-DM1 ADC

ADC-W-222 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody (SN8) conjugated via a SPP linker to DM1

Anti-CD79b (SN8)-MCC-DM1 ADC

ADC-W-223 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody (SN8) conjugated via a MCC linker to DM1

Anti-CD79b (SN8)-Mc-MMAF ADC

ADC-W-225 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody (SN8) conjugated via a Mc linker to MMAF

Anti-CD79B (Polatuzumab )-SMCC-DM1 ADC

ADC-W-2554 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody conjugated via a SMCC linker to DM1

Anti-CD79B (Polatuzumab )-SPDB-DM4 ADC

ADC-W-2555 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody conjugated via a SPDB linker to DM4

Anti-CD79B (Polatuzumab )-MC-MMAF ADC

ADC-W-2556 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody conjugated via a MC linker to MMAF

Anti-CD79B (Polatuzumab)-VC-MMAE ADC

ADC-W-379 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody conjugated via a VC linker to a MMAE

Cluster of Differentiation 79B (CD79b) Antibody

abx413392-01mg 0.1 mg
EUR 439
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody

abx413832-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody

abx413835-25ug 25 ug
EUR 272
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody

abx413836-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody

abx413839-25ug 25 ug
EUR 272
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79B) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster of Differentiation 79B (CD79B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cluster of Differentiation 79B (CD79B) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

CD79B sgRNA CRISPR Lentivector set (Human)

K0403901 3 x 1.0 ug
EUR 339

Cd79b sgRNA CRISPR Lentivector set (Rat)

K7064001 3 x 1.0 ug
EUR 339

Cd79b sgRNA CRISPR Lentivector set (Mouse)

K3317901 3 x 1.0 ug
EUR 339

Human, CD79B Human Recombinant Protein, Sf9

PROTP40259-1 Regular: 10ug
EUR 317
Description: CD79B Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 140 amino acids (29-159a.a.) and having a molecular mass of 16.3kDa (Molecular size on SDS-PAGE will appear at approximately 18-28 kDa).;CD79B is expressed with a 9 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Anti-CD79B (Polatuzumab Vedotin), Humanized Antibody

A2178-100 100 µg
EUR 510

Cluster of Differentiation 79B (CD79b) Antibody (APC)

abx139337-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

Cluster of Differentiation 79B (CD79b) Antibody (PE)

abx139339-100tests 100 tests
EUR 481
  • Shipped within 5-12 working days.

Rat Anti Mouse Cd79b Monoclonal Antibody,FITC

CABT-49744RM 0.1 mg
EUR 663

Mouse Anti Human Cd79b Monoclonal Antibody,RPE

CABT-52808MH 100 TEST
EUR 710

Hamster Anti Mouse Cd79b Monoclonal Antibody,RPE

CABT-54574HM 100 TEST
EUR 533

Anti-CD79b (clone huMA79b.v18)-Mc-MMAF ADC

ADC-W-024 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79b monoclonal antibody (clone huMA79b

Anti-CD79b (clone huMA79b.v28)-Mc-MMAF ADC

ADC-W-027 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79b monoclonal antibody (clone huMA79b

Anti-CD79b (clone ch10D10)-Mc-MMAF ADC

ADC-W-030 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79b monoclonal antibody (clone ch10D10) conjugated via a Mc linker to MMAF

Anti-CD79b (clone MA79b)-Mc-MMAF ADC

ADC-W-033 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79b monoclonal antibody (clone MA79b ) conjugated via a Mc linker to MMAF

Anti-CD79b (clone MA79b)-Mc-MMAF ADC

ADC-W-034 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79b monoclonal antibody (clone MA79b ) conjugated via a Mc linker to MMAF

Anti-CD79b (clone ch2F2)-SMCC-DM1 ADC

ADC-W-168 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody (clone ch2F2) conjugated via a SMCC linker to DM1

Anti-CD79b (clone ch2F2)-Mc-MMAF ADC

ADC-W-173 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody (clone ch2F2) conjugated via a Mc linker to MMAF

Anti-CD79b (clone ch2F2)-Mc-MMAF ADC

ADC-W-174 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody (clone ch2F2) conjugated via a Mc linker to MMAF

Anti-CD79b (clone 10D10)-MCC-DM1 ADC

ADC-W-237 1mg Ask for price
Description: This ADC product is comprised of an anti-CD79B monoclonal antibody (clone 10D10) conjugated via a MCC linker to DM1

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNUB1844-100 100uL
EUR 264
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), Concentration: 0.2mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNUB1844-50 50uL
EUR 405
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), 1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNUB1844-500 500uL
EUR 513
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), Concentration: 0.2mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC551844-100 100uL
EUR 233
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF555 conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC551844-500 500uL
EUR 545
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF555 conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC611844-100 100uL
EUR 233
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF660R conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC611844-500 500uL
EUR 545
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF660R conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC471844-100 100uL
EUR 233
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF647 conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC471844-500 500uL
EUR 545
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF647 conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC041844-100 100uL
EUR 233
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF405S conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC041844-500 500uL
EUR 545
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF405S conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC051844-100 100uL
EUR 233
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF405M conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC051844-500 500uL
EUR 545
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF405M conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC401844-100 100uL
EUR 233
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF640R conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC401844-500 500uL
EUR 545
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF640R conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC431844-100 100uL
EUR 233
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF543 conjugate, Concentration: 0.1mg/mL

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC431844-500 500uL
EUR 545
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF543 conjugate, Concentration: 0.1mg/mL

Cluster of Differentiation 79B (CD79b) Antibody (FITC)

abx413391-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody (RPE)

abx413393-100tests 100 tests
EUR 592
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody (RPE)

abx413394-25tests 25 tests
EUR 314
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody (FITC)

abx413833-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody (RPE)

abx413834-100tests 100 tests
EUR 592
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody (FITC)

abx413837-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

Cluster of Differentiation 79B (CD79b) Antibody (FITC)

abx413838-25ug 25 ug
EUR 272
  • Shipped within 1 week.

CD79b (B-Cell Marker) (IGB/1844) Antibody

BNC701844-100 100uL
EUR 233
Description: Primary antibody against CD79b (B-Cell Marker) (IGB/1844), CF770 conjugate, Concentration: 0.1mg/mL

Throughout the text we highlight the advantages and disadvantages of each methodology and discuss the most promising developments in their path from bench to bedside.

Leave A Comment